A kit for detecting single-nucleotide polymorphism in the signal peptide and intron I of the lipoprotein lipase gene in goats
| Year | 2017 |
| Cathegory | Patents |
| Internal link | 17187.pdf |
| Abstract | The kit for detecting single-nucleotide polymorphism in the signal peptide and intron I of the lipoprotein lipase gene in goats which is characterized by comprising primers having the composition of K LPL F: 5´GTG CCC TGC ATC TCC TAC AG 3´ (20 mer), K LPL R: 5´ AGG GGC CCT GGA ATG AAA TG 3´ (20 mer), for amplification of the required 537 bp DNA segment, and further includes the extension primers of K-105R Sh1 (AT)12CGGCGACCAGCCCTC for detecting genetic polymorphism at the position of 103 bp G/A, K-186F Sh2 (AT)2CTCAGTGGCCATTTGCACAC for detecting genetic polymorphism at the position of185 bp G/T, K-258R Sh3 (AT)5CGCGACCCTATCTGAGGCAA for detecting genetic polymorphism at the position of 257 bp C/T a K-302R Sh4 (AT)6AGATCGGAGGAAAAGTCTCCTC for detecting genetic polymorphism at the position of 301 bp G/A. |
VÚŽV v.v.i. > List of our publications >
